Marker name | WCS1824 | ||
---|---|---|---|
Marker category | White_clover_SSR | ||
Primer sequences | Fw | GCCGAGTGATTTCTCCATGT | |
Rv | CAGCATCTTCCGAATTCCAT | ||
EST/Genome sequences | WCC30A21 | ||
Lines | |||
PIC | Value | ||
Lines | |||
Map | Woogenellup x Daliak [SNP] | Linkage | LG4 |
Position | 35436.2 | ||
Denmark x DGI007 [SSR] | Linkage | LGc | |
Position | 39.49 | ||
SNP | Position | ||
Method | |||
SSR | Fragment size | 204 | |
Pattern* | AGC | ||
Repeat count | 5 | ||
Method | PCR | TD | |
Detection | 10% acrylamide | ||
Multiplex | |||
Gel image | WCS1824 | ||
Enzyme | |||
Related markers | Marker name | WCS1824 | |
Species | Trifolium repens | ||
Comments |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.