| Marker name | RCS7150 | ||
|---|---|---|---|
| Marker category | Red_clover_SSR | ||
| Primer sequences | Fw | AGAACCCTCTGCAGATTCAA | |
| Rv | AACTGCACCGTCGAGTTCTT | ||
| EST/Genome sequences | BB927327 | ||
| Lines | |||
| PIC | Value | ||
| Lines | |||
| Map | Woogenellup x Daliak [SNP] | Linkage | LG3 |
| Position | 19266.6 | ||
| Woogenellup x Daliak [SSR] | Linkage | LGc | |
| Position | 130.38 | ||
| Denmark x DGI007 [SSR] | Linkage | LGa | |
| Position | 5.33 | ||
| SNP | Position | ||
| Method | |||
| SSR | Fragment size | 299 | |
| Pattern* | AAT | ||
| Repeat count | 15 | ||
| Method | PCR | TD | |
| Detection | 10% acrylamide | ||
| Multiplex | |||
| Gel image | RCS7150 | ||
| Enzyme | |||
| Related markers | Marker name | RCS7150 | |
| Species | Trifolium pratense | ||
| Comments | |||
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.