Marker name | RCS6448 | ||
---|---|---|---|
Marker category | Red_clover_SSR | ||
Primer sequences | Fw | CTCACTTCATTGCACCTCCA | |
Rv | CCGGTGCCAACAACTTTATC | ||
EST/Genome sequences | BB919087 | ||
Lines | |||
PIC | Value | 0.748094 | |
Lines | 48 | ||
Map (Denmark x DGI007 [SSR]) |
Linkage | LGg | |
Position | 78.45 | ||
SNP | Position | ||
Method | |||
SSR | Fragment size | 275 | |
Pattern* | AAC | ||
Repeat count | 14 | ||
Method | PCR | TD | |
Detection | 10% acrylamide | ||
Multiplex | |||
Gel image | RCS6448 | ||
Enzyme | |||
Related markers | Marker name | RCS6448 | |
Species | Trifolium pratense | ||
Comments | Related marker: AP007443 ; Related species: Lotus japonicus |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.