| Marker name | RCS5288 | ||
|---|---|---|---|
| Marker category | Red_clover_SSR | ||
| Primer sequences | Fw | TTCTTCAATTGTTTGTGGCAG | |
| Rv | TGAGTGGAAGAGGATTTGGG | ||
| EST/Genome sequences | BB913012 | ||
| Lines | |||
| PIC | Value | 0.709319 | |
| Lines | 48 | ||
| Map | Woogenellup x Daliak [SNP] | Linkage | LG8 |
| Position | 10407.5 | ||
| Woogenellup x Daliak [SSR] | Linkage | LGh | |
| Position | 97.21 | ||
| SNP | Position | ||
| Method | |||
| SSR | Fragment size | 240 | |
| Pattern* | AAT | ||
| Repeat count | 17 | ||
| Method | PCR | TD | |
| Detection | 10% acrylamide | ||
| Multiplex | |||
| Gel image | RCS5288 | ||
| Enzyme | |||
| Related markers | Marker name | RCS5288 | |
| Species | Trifolium pratense | ||
| Comments | Related marker: AP006364 ; Related species: Lotus japonicus | ||
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.