Sub clover Marker Database

RCS5243 Information

Marker name RCS5243
Marker category Red_clover_SSR
Primer sequences Fw CGGCACTTTCTTCTACCCAA
Rv CAGTGAATGGTGGTGTCGTC
EST/Genome sequences BB912671
Lines
PIC Value
Lines
Map Woogenellup x Daliak [SNP] Linkage LG8
Position 48.51
Woogenellup x Daliak [SSR] Linkage LGh
Position 0.0
Denmark x DGI007 [SSR] Linkage LGh
Position 22.79
SNP Position
Method
SSR Fragment size 165
Pattern* AAC
Repeat count 15
Method PCR TD
Detection 10% acrylamide
Multiplex
Gel image
Enzyme
Related markers Marker name RCS5243
Species Trifolium pratense
Comments

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Trifolium subterraneum