| Marker name | RCS5081 | ||
|---|---|---|---|
| Marker category | Red_clover_SSR | ||
| Primer sequences | Fw | AAATCCACCAGACCAGTTGC | |
| Rv | CGAGAGGCTCCGACAATTAC | ||
| EST/Genome sequences | BB911407 | ||
| Lines | |||
| PIC | Value | ||
| Lines | |||
| Map (Denmark x DGI007 [SSR]) |
Linkage | LGb | |
| Position | 132.66 | ||
| SNP | Position | ||
| Method | |||
| SSR | Fragment size | 141 | |
| Pattern* | GGA | ||
| Repeat count | 21 | ||
| Method | PCR | TD | |
| Detection | 10% acrylamide | ||
| Multiplex | |||
| Gel image | RCS5081 | ||
| Enzyme | |||
| Related markers | Marker name | RCS5081 | |
| Species | Trifolium pratense | ||
| Comments | Related marker: mth2-60a22 ; Related species: Medicago truncatula | ||
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.