| Marker name | RCS5056 | ||
|---|---|---|---|
| Marker category | Red_clover_SSR | ||
| Primer sequences | Fw | CGCTAGATTCTGCTCTCGCT | |
| Rv | TGAAAACGCCGAAGAGAAGT | ||
| EST/Genome sequences | BB911300 | ||
| Lines | |||
| PIC | Value | 0.725229 | |
| Lines | 48 | ||
| Map | Woogenellup x Daliak [SNP] | Linkage | LG5 |
| Position | 6075.58 | ||
| Woogenellup x Daliak [SSR] | Linkage | LGe | |
| Position | 33.7 | ||
| SNP | Position | ||
| Method | |||
| SSR | Fragment size | 226 | |
| Pattern* | AAAG | ||
| Repeat count | 20 | ||
| Method | PCR | TD | |
| Detection | 10% acrylamide | ||
| Multiplex | |||
| Gel image | RCS5056 | ||
| Enzyme | |||
| Related markers | Marker name | RCS5056 | |
| Species | Trifolium pratense | ||
| Comments | |||
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.