Marker name | RCS4695 | ||
---|---|---|---|
Marker category | Red_clover_SSR | ||
Primer sequences | Fw | AAACAAATCCAGCACCGAAC | |
Rv | TTGGAGTAACCACCGTAGCC | ||
EST/Genome sequences | BB909079 | ||
Lines | |||
PIC | Value | ||
Lines | |||
Map | Woogenellup x Daliak [SNP] | Linkage | LG4 |
Position | 32547.6 | ||
Denmark x DGI007 [SSR] | Linkage | LGh | |
Position | 37.35 | ||
SNP | Position | ||
Method | |||
SSR | Fragment size | 197 | |
Pattern* | AG | ||
Repeat count | 16 | ||
Method | PCR | TD | |
Detection | 10% acrylamide | ||
Multiplex | |||
Gel image | RCS4695 | ||
Enzyme | |||
Related markers | Marker name | RCS4695 | |
Species | Trifolium pratense | ||
Comments | Related marker: mth2-15j7 ; Related species: Medicago truncatula |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.