Marker name | RCS3657 | ||
---|---|---|---|
Marker category | Red_clover_SSR | ||
Primer sequences | Fw | CGAATGTCCAGAAGAAAATGC | |
Rv | ACAATGGCGTTTCCAGCTAC | ||
EST/Genome sequences | DE243780 | ||
Lines | |||
PIC | Value | ||
Lines | |||
Map | Woogenellup x Daliak [SNP] | Linkage | LG7 |
Position | 23643.2 | ||
Woogenellup x Daliak [SSR] | Linkage | LGg | |
Position | 264.77 | ||
SNP | Position | ||
Method | |||
SSR | Fragment size | 171 | |
Pattern* | AATG | ||
Repeat count | 16 | ||
Method | PCR | TD | |
Detection | 10% acrylamide | ||
Multiplex | |||
Gel image | RCS3657 | ||
Enzyme | |||
Related markers | Marker name | RCS3657 | |
Species | Trifolium pratense | ||
Comments | Related marker: mth2-7g7 ; Related species: Medicago truncatula |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.