Marker name | RCS3279 | ||
---|---|---|---|
Marker category | Red_clover_SSR | ||
Primer sequences | Fw | TTTCTCTTGTTCCATTGGGG | |
Rv | CATTGTTGTCGCGGTTATTG | ||
EST/Genome sequences | DE234533 | ||
Lines | |||
PIC | Value | ||
Lines | |||
Map (Denmark x DGI007 [SSR]) |
Linkage | LGe | |
Position | 271.88 | ||
SNP | Position | ||
Method | |||
SSR | Fragment size | 288 | |
Pattern* | AAT | ||
Repeat count | 17 | ||
Method | PCR | TD | |
Detection | 10% acrylamide | ||
Multiplex | |||
Gel image | RCS3279 | ||
Enzyme | |||
Related markers | Marker name | RCS3279 | |
Species | Trifolium pratense | ||
Comments | Related marker: AP004978, mth2-30e7 ; Related species: Lotus japonicus, Medicago truncatula |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.