| Marker name | RCS1863 | ||
|---|---|---|---|
| Marker category | Red_clover_SSR | ||
| Primer sequences | Fw | CTGAAAGCACAAGGCACAAA | |
| Rv | TCAAGTTGAAGCGTTGGATG | ||
| EST/Genome sequences | BB932101 | ||
| Lines | |||
| PIC | Value | 0.55125 | |
| Lines | 48 | ||
| Map | Woogenellup x Daliak [SNP] | Linkage | LG8 |
| Position | 1718.58 | ||
| Woogenellup x Daliak [SSR] | Linkage | LGh | |
| Position | 71.38 | ||
| SNP | Position | ||
| Method | |||
| SSR | Fragment size | 201 | |
| Pattern* | AAC | ||
| Repeat count | 21 | ||
| Method | PCR | TD | |
| Detection | 10% acrylamide | ||
| Multiplex | |||
| Gel image | RCS1863 | ||
| Enzyme | |||
| Related markers | Marker name | RCS1863 | |
| Species | Trifolium pratense | ||
| Comments | Related marker: AP007638, mte1-29a5 ; Related species: Lotus japonicus, Medicago truncatula | ||
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.