Marker name | RCS1534 | ||
---|---|---|---|
Marker category | Red_clover_SSR | ||
Primer sequences | Fw | ACCCATTTGATTCTCCACCA | |
Rv | CCGAATTTGGCTTTTGAGAG | ||
EST/Genome sequences | BB930222 | ||
Lines | |||
PIC | Value | ||
Lines | |||
Map | Woogenellup x Daliak [SNP] | Linkage | LG6 |
Position | 592.36 | ||
Woogenellup x Daliak [SSR] | Linkage | LGf | |
Position | 60.94 | ||
SNP | Position | ||
Method | |||
SSR | Fragment size | 169 | |
Pattern* | AAG | ||
Repeat count | 22 | ||
Method | PCR | TD | |
Detection | 10% acrylamide | ||
Multiplex | |||
Gel image | RCS1534 | ||
Enzyme | |||
Related markers | Marker name | RCS1534 | |
Species | Trifolium pratense | ||
Comments |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.