Marker name | RCS1113 | ||
---|---|---|---|
Marker category | Red_clover_SSR | ||
Primer sequences | Fw | CATCCTCCAAAACCCTCCTT | |
Rv | TCATCATCATCACCGGAAAG | ||
EST/Genome sequences | DE217912 | ||
Lines | |||
PIC | Value | 0.805311 | |
Lines | 48 | ||
Map | Woogenellup x Daliak [SNP] | Linkage | LG5 |
Position | 16334.1 | ||
Woogenellup x Daliak [SSR] | Linkage | LGe | |
Position | 83.2 | ||
SNP | Position | ||
Method | |||
SSR | Fragment size | 158 | |
Pattern* | GGT | ||
Repeat count | 21 | ||
Method | PCR | TD | |
Detection | 10% acrylamide | ||
Multiplex | |||
Gel image | RCS1113 | ||
Enzyme | |||
Related markers | Marker name | RCS1113 | |
Species | Trifolium pratense | ||
Comments | Related marker: AP009675 ; Related species: Lotus japonicus |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.