Marker name | RCS0199 | ||
---|---|---|---|
Marker category | Red_clover_SSR | ||
Primer sequences | Fw | AAATCGCCACAACACTTTACA | |
Rv | GTTTACCCATGTGGCTCTTCA | ||
EST/Genome sequences | DE213437 | ||
Lines | |||
PIC | Value | 0.750269 | |
Lines | 48 | ||
Map (Woogenellup x Daliak [SNP]) |
Linkage | LG2 | |
Position | 3158.29 | ||
SNP | Position | ||
Method | |||
SSR | Fragment size | 150 | |
Pattern* | AAC | ||
Repeat count | 17 | ||
Method | PCR | TD | |
Detection | 10% acrylamide | ||
Multiplex | |||
Gel image | RCS0199 | ||
Enzyme | |||
Related markers | Marker name | RCS0199 | |
Species | Trifolium pratense | ||
Comments | Related marker: mth2-7h21 ; Related species: Medicago truncatula |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.